Ana Arı – Üretimi – Satışı

 ANADOLU ANA ARISI | KARNİYOL ANA ARI | YIĞILCA ANA ARISI | KAFKAS ANA ARISI | BELFAST ANA ARI | İTALYAN ANA ARI |
(Apis mellifera anatoliaca) - (Apis mellifera carnica)-(Apis mellifera Caucasica)-(Apis mellifera ligustica)

Arı Irkları ve Özellikleri

Amaç: Kafkas (Apis mellifera caucasica), İtalyan (Apis mellifera ligustica), Karniyol (Apis
mellifera carnica) ve Anadolu ırkı (Apis mellifera anatoliaca) arıların moleküler ve
filo genetik özelliklerinin belirlenmesi

Arı Irkları ve Özellikleri
12 Aralık 2018 - 0:14

Kafkas (Apis mellifera caucasica), İtalyan (Apis mellifera ligustica),Karniyol (Apis mellifera carnica) ,Anadolu Irkı (Apis mellifera anatoliaca) Arılarının Moleküler ve Filogenetik Özellikleri nelerdir.?

Materyal ve Metot:  Irklara aitörneklere dokular, bir petri kabı içinde bisturi yardımıyla parçalandı ve fenol: kloro form: izo amil alkol yöntemi ile DNA izolasyonu yapılmıştır.

PZR(Polimeraz Zincir Reaksiyonu) reaksiyonunda kaynak DNA olarak genomik DNAkullanılmıştır.

PZR reaksiyonu yarı bozuk (18S rRNA ve cox1 F ve R) primerlerlekurulmuştur; 2.5 µl 10X tampon, 2.5 µl 25 mM MgCl2, 2 µl 2.5 µM dNTP karışımı, 2.5 µl F,2.5 µl R, 0.5 µl genomik DNA, 0.2 µl Taq DNA Polimeraz enzimi (5u/µl) üzerine son hacmi25 µl olacak biçimde12.3µl ddH2O eklenmiştir.

PCR 94ºC’de 2 dakika, 94ºC’de 1 dakika, 50ve 55ºC’de 1 dakika, 72ºC’de 1 dakika, 72ºC’de 4 dakika ve 4ºC’de ∞ olacak şekildeyapılmıştır.

PCR sonucu elde ürünler agaroz jelde analiz edildikten sonra ürünler jeldenkesilerek saflaştırılacak ve dizi analizi yapılmıştır.

Dizi analizi sonuçları ClustalW(1.83),dikey hizalanmış ve MEGA5 programı ile filogenetik ağaç oluşturulmuştur.

Bulgular: Apis mellifera türlerinden genomik DNA izolasyonuna ait deney sonuçları  belirtilmiştir.

Apis mellifera türlerinden genomik DNA’sının agaroz jelden görüntüsü.M:λDNAEcoRI/Hind III Marker, 1-2:(Apis mellifera türleri genomik DNA’sının agarozM 1 221 kb5th International Muğla Beekeeping and Pine Honey Congress1-5 November, 2016, Fethiye, TURKEY12jelden görüntüsü (% 0.8’lik agarozjel’e 1µl λDNAEcoRI/Hind III marker ile birlikteyüklenmiş ve 90 V 50dakika yürütülmüştür).

Apis mellifera türlerinden 18S rRNA ve cox1genlerinin eldesiŞekil 3.2. Apis mellifera türlerinden 18S rRNA ve cox1 genleri PCR reaksiyonunun agarozjelden görüntüsü. M:50bp Marker, 1-4:Orthrias genomik DNA’sından 18S rRNA genleriagaroz jelden görüntüsü (% 0.8’likagarozjel’e 1µl λDNAEcoRI/Hind III marker ile birlikteyüklenmiş ve 90 V 50 dakika yürütülmüştür).

Elde edilen ürünler jelden kesilmiş ve beklenen tahmini ürün büyüklükler olan 1800 bç ve1300 bç’lık ürünler jelden saflaştırılmış.

Saflaştırılan ürünler BeckmanCoulter CEQ8000DNA dizi analiz aletinde dizi analizine tabii tutulmuş ve kullanılan primer bilgileritemizlenmiştir.

Nükleotid dizisi belirlenen PZR ürünleri NCBI veritabanında analiz edilmiştir.MairaGCGTAAATTACCCACTCCCAGCACGGGGAGGTAGTGACGAAAAATAACAATACAGGACTH.illucensGCGTAAATTACCCACTCCCAGTACGGGGAGGTAGTGACGAAAAATAACATACAGGACTD.simulansGCGTAAATTACCCACTCCCAGCTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTM.domesticaGCGTAAATTACCCACTCCCAGCTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTB.purpureaACGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACAGACGGGACTL.anatiferaGCGTAACTTACCCACTCCCAGTTCAGGGAGGTAGTGACAATAAATACCTTACAGAGGTCTHumanGCGCAAATTACCCACTCCCGACCCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTRatGCGCAAATTACCCACTCCCGACCCGGGGAGGTAGTGACGAAAAATAACAATACAGGACT1 2 3 41,8 kb1 2 3 41,3 kb5th International Muğla Beekeeping and Pine Honey Congress1-5 November, 2016, Fethiye,

TURKEY13R.lentiginosusGCGCAAATTACCCACTCCCGACTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTA. m. caucasicaGCGCAAATTACCCACTCCCGACTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTA.m.

ligusticaGCGCAAATTACCCACTCCCGACTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTm.

carnicaGCGCAAATTACCCACTCCCGACTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTA.m.

anatoliacaGCGCAAATTACCCACTCCCGACTCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTB.

floridaeGCGCAAATTACCCACTCCCGACTCGGGGAGGTAGTGACGAAAAATAACAATACGGGACTS.plicataGCGCAAATTACCCATTCCCGACACGGGGAGGTAGTGACGAAAAATAACAATACAGGACTG.carolinensisGCNCNNATTACCCACTCCGACTNGGGNANNNNGTNANNAAAAATAACA-ATACAGGACTC.

sapidusACGCNNATTACCCACTCCGGCNCGGGGAGGTAGTGACNAAAAATAACG-ATGCGAGACTRiceTGGAATGCTTCGGATCCCTTAAAC—GCATACCGCACCTAAATGATGCCGGTATAGCCGG

Belirli türlerde 18S rRNA ve cox1 geninine ait hizalama sonuçları.18S rRNA ve cox1genlerinin evrimsel analizi yapılmıştır.

Bunun için ilk olarak diğer türlereait dizi bilgilerine NCBI veri tabanından ulaşılmıştır.

Filogenetik ilişkilerini belirlemek içinnükleotid dizileri EBI veri tabanındakidbclusterile dikey hizalanmıştır (Şekil 3). Evrimselyakınlıklarını belirlemek için seç-bağla (bootstrap) yöntemi 1000 tekrarlı kullanılarak Ağaçanalizinde; belirli türler kendi aralarında benzerlik gösterirken, Apismellifera türleri ise kendiaralarında benzerlik göstermiştir.

Sonuç: Yapılan filogenetik analizleri sonucunda Kafkas (Apis mellifera caucasica), İtalyan(Apis mellifera ligustica), Karniyol (Apis mellifera carnica) ve Anadolu ırkı (Apis melliferaanatoliaca) %98 benzer homoloji gösterdiği belirlenmiştir.

Ayrıca Kafkas (Apis melliferacaucasica) ırkının diğer ırklara göre aynı kökten gelen fakat farklı bir daldan geldiği belirlenmiştir.

Kaynak :

1.Kafkas Üniversitesi, Veteriner Fakültesi, Zootekni Anabilim Dalı, Kars, Türkiye 

2.Mehmet Akif Ersoy Üversitesi, Veteriner Fakültesi, Zootekni Anabilim Dalı, Burdur

3.Kafkas Üniversitesi, Mühendislik Mimarlık Fakültesi, Biyomühendislik Bölümü, Kars

HABER HAKKINDA GÖRÜŞ BELİRT
Yorum Yok

Yorum yapabilmek için giriş yapmalısınız.

ANA ARIANA ARI | SATIŞIANA ARI ÜRETİMİARI ÜRÜNLERİ
Hangi arama motoru Bizi tercih ediliyor?
ANA ARIANA ARI | SATIŞIANA ARI ÜRETİMİAnadolu Ana Arısı | Üretimi | SatışıBelfast-Buckfast | Üretimi | Satışıİtalyan Ana Arı | Üretimi | SatışıKafkas Ana Arı | Üretimi | SatışıKarniyol Ana Arı | Üretimi | SatışıYığılca Ana Arı | Üretimi | Satışı
Ana Arı Kalitesinin Önemi
ANA ARIANA ARI | SATIŞIAnadolu Ana Arısı | Üretimi | SatışıBelfast-Buckfast | Üretimi | Satışıİtalyan Ana Arı | Üretimi | SatışıKafkas Ana Arı | Üretimi | SatışıKarniyol Ana Arı | Üretimi | SatışıYığılca Ana Arı | Üretimi | Satışı
Kaliteli Ana Arı Nasıl Üretilir.?
ANA ARIANA ARI | SATIŞIANA ARI ÜRETİMİAnadolu Ana Arısı | Üretimi | SatışıBelfast-Buckfast | Üretimi | Satışıİtalyan Ana Arı | Üretimi | SatışıKafkas Ana Arı | Üretimi | SatışıKarniyol Ana Arı | Üretimi | SatışıYığılca Ana Arı | Üretimi | Satışı
Damizlik Ana Ari
ANA ARIANA ARI | SATIŞIARI ÜRÜNLERİ
ANA ARI ÜRETİMİ
ANA ARIANA ARI | SATIŞIANA ARI ÜRETİMİARI ÜRÜNLERİ
Hangi arama motoru Bizi tercih ediliyor?
ANA ARIANA ARI | SATIŞIANA ARI ÜRETİMİAnadolu Ana Arısı | Üretimi | SatışıBelfast-Buckfast | Üretimi | Satışıİtalyan Ana Arı | Üretimi | SatışıKafkas Ana Arı | Üretimi | SatışıKarniyol Ana Arı | Üretimi | SatışıYığılca Ana Arı | Üretimi | Satışı
Ana Arı Kalitesinin Önemi
ANA ARIANA ARI | SATIŞIAnadolu Ana Arısı | Üretimi | SatışıBelfast-Buckfast | Üretimi | Satışıİtalyan Ana Arı | Üretimi | SatışıKafkas Ana Arı | Üretimi | SatışıKarniyol Ana Arı | Üretimi | SatışıYığılca Ana Arı | Üretimi | Satışı
Kaliteli Ana Arı Nasıl Üretilir.?
ANA ARIANA ARI | SATIŞIANA ARI ÜRETİMİAnadolu Ana Arısı | Üretimi | SatışıBelfast-Buckfast | Üretimi | Satışıİtalyan Ana Arı | Üretimi | SatışıKafkas Ana Arı | Üretimi | SatışıKarniyol Ana Arı | Üretimi | SatışıYığılca Ana Arı | Üretimi | Satışı
Damizlik Ana Ari
ANA ARIANA ARI | SATIŞIARI ÜRÜNLERİ
ANA ARI ÜRETİMİ

Copyrigth 2003-2019 © www.aridostlari.com tüm hakları saklıdır.sitesinde yer alan bütün içerik,5846 numaralı yasa telif hakları kanunu ile korunmaktadır.